Her pulse is 118 and thready, blood pressure is 88/72, respiratory rate

Her pulse is 118 and thready, blood pressure is 88/72, respiratory rate is 28, and pulse oxymetry is 88%. when you call her name, she opens her eyes but does not answer any questions.

2 months ago

Solution 1

Guest Guest #4864
2 months ago
she opens her eyes but does not answer any questions. This is because she is suffering from dementia. She does not know  what to do in your shoes anymore because she lost her humantiy.

📚 Related Questions

Question
4b. why would the vena cava be classified as a vein? all veins carry blood back to the heart, except for the pulmonary vein. the vena cava empty into the right side of the heart, so they technically bring blood to the
Solution 1
The answer is that all veins carry blood back to the heart, except for the pulmonary vein. the vena cava empty into the right side of the heart, so they technically bring blood to the main atrium.
Question
Infants need fat because it aids in absorption of several vitamins and also helps the ______________ to develop.nervous systemkidneysskinreproductive system
Solution 1

Answer: nervous system

Infants need fat as aid in absorption of several vitamins. IT also helps the brain or the nervous system to develop normally. Fats insulate all nervous system tissues in the body. Getting enough of this help infants feel full. It is also essential for growth and development. 

Question
Match these cell cycle checkpoints to their role in genome integrity is the dna replicated with out damage?
Solution 1
Match these cell cycle checkpoints to their role in genome integrity:Is the DNA replicated with out damage?Are the chromosomes lined up correctly attached to the mitotic spindle?
Does the cell have a enough nutrients, proteins and growth factors?Is the cellular DNA badly damaged during the replication process?

G2 
Is the DNA replicated with out damage?

M
Are the chromosomes lined up correctly attached to the mitotic spindle?

G1/S 
Does the cell have a enough nutrients, proteins and growth factors?

Intra-S (during S-phase)
Is the cellular DNA badly damaged during the replication process?

Question
1-How does the osmolarity of the kidney interstitial fluid change from the cortex to the inner medulla? Why is this important? 2-• In the medulla, the solute concentration is high which allows water to diffuse out of the Loop of Henle through osmosis. The vasa recta capillaries are also in the medulla. How does their solute and water concentration change along the loop?
Solution 1

Osmolarity of the kidney’s interstitial fluid increases from the cortex to inner medulla. This ensures that there is a concentration gradient that allows for osmosis to take place along the kidney tubules in a kind of countercurrent flow exchange system. This way most, amount of water can be reabsorbed.


The same occurs in the loop of Henle in a process called countercurrent multiplication. The descending loop actively takes up solutes hence making the blood plasma in the the vasa recta highly concentrated. In the ascending loop, therefore, water in the tubules is reabsorbed by osmosis hence making urine more concentrated as it gets to the bladder.






Question
When westerners are asked to recall autobiographical memories, this part of their brain is activated. temporal lobe motor cortex medial frontal cortex occipital lobe?
Solution 1
The correct answer is medial frontal cortex.

Autobiographical memory is part of the explicit memory and it is a memory system which consists of episodes recollected from a person's life. It consists each person's sense of personal past history and present self. The part of the brain connected to this type of memory is the medial frontal cortex.
Question
When two pink flowers (rw) are crossed, there are four equally likely possible outcomes for the genetic makeup of the offspring: red (rr), pink (rw), pink (wr), and white (ww). complete the punnett square. if two pink flowers are crossed, what is the probability that the offspring is?
Solution 1
You get the following:
RR - red - 0.25
RW- pink - 0.50
WW- white - 0.25

So 50% chance of being pink.
Question
Paraquat is a general herbicide that kills most types of plants. in a population of ferns, it was found that 40% of the gametophytes showed resistance to paraquat (resistance is caused by a recessive allele). what is the expected frequency of resistant sporophytes in this population?\
Solution 1
I'm not 100% sure but i think the frequency be 2 resistant out of every 5 plants
Question
Suppose the correlation between height and weight for adults is +0.80. what proportion (or percent) of the variability in weight can be explained by the relationship with height?
Solution 1

Correlation is a mutual relationship or connection between two or more things. In our example a correlation of +0.80 between height and weight for adults means. A) 80%. The correlation measures the extent to which knowing the value of height helps you to predict the value of weight. Even with a high correlation of +0.80, we cannot really expect two persons with exactly the same height to have exactly the same weight. Almost always there is some difference.  What this says is that, as height goes higher, the weight goes higher, too. 

Question
Where are the choroid plexuses found, and what is their function?
Solution 1
It is found in the ventricles of the brain. Its function is to "The choroid plexus serves two important functions in the body. It produces cerebrospinal fluid and helps to provide a barrier, which protects the brain and other central nervous system tissue from toxins."
Question
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?
Solution 1

It would bind to the part that has a complementary sequence. Since A pairs with T and C pairs with G then it would bind to  ttagc sequence on the  DNA strand. The two DNA pieces would also align in anti-parallel alignment.